| Detail of EST/Unigene TCMT43195 |
| Acc. | TCMT43195 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Aldo-keto reductase family 4 member C9 OS=Arabidopsis thaliana E-value=0; Aldo-keto reductase family 4 member C10 OS=Arabidopsis thaliana E-value=0; Aldo-keto reductase family 4 member C11 OS=Arabidopsis thaliana E-value=0; Aldo-keto reductase family 4 member C8 OS=Arabidopsis thaliana E-value=0; Aldose reductase OS=Hordeum vulgare E-value=1e-62; |
| Length | 1355 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought (9 ESTs); MT_JAS_ROOR (6 ESTs); MT_INSECT (5 ESTs); MT_DSIL (5 ESTs); MT_DSTEM2 (3 ESTs); MT_JCVI-MT3 (3 ESTs); MT_JCVI-MT1 (2 ESTs); MT_SROOT_KV1 (2 ESTs); MTGIM (2 ESTs); MtBC_GLOMUS (2 ESTs); MT_DROOT (2 ESTs); MT_Shoots (1 ESTs); MtSNF (1 ESTs); MT_JCVI-MT2 (1 ESTs); GLSD (1 ESTs); MT_TRI (1 ESTs); MT_ECELL (1 ESTs); MT_SIRRA (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_HOGA (1 ESTs); MT_ROOTPHOS (1 ESTs); MtBA (1 ESTs); MT_CDS (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_MGHG (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_DLEAF (1 ESTs); MT_GSEED (1 ESTs); |
| Sequence | GAGAAAAACAAAGAAGAAAATGGCCACAGCAATCAAATTCTTTCAGTTGAACACTGGTGC |
| EST members of Unigene | BT052019 AL383031 AL383030 BE319877 BE320684 CX541024 CX528439 AW694657 AW696127 AW692860 BG447974 EV259321 EV257304 DW016483 AW329160 AJ499541 AJ500091 AW774316 BQ139493 BG453273 BF521363 BF519721 BF519599 BE123903 AW776733 AJ845859 CA989800 BQ155774 CX535255 CX533726 CX530712 CX530579 CX530318 CX529276 CB893065 BE202914 BE202913 AL371381 BE942075 BG450138 BE247993 BE247907 BF636060 BF633700 BF633027 BF632781 BF632534 BF632112 BI268058 BI267721 BI266970 BF641417 BF641356 EY478408 EY477335 EY474749 GE351839 ES611015 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00930 Caprolactam degradation > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00002 alcohol dehydrogenase (NADP+); Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00002 alcohol dehydrogenase (NADP+); Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00011 aldehyde reductase |
| EC | 1.1.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.46053.1.S1_at
|
| Corresponding NCBI Gene | 818354 |
| Trichome-related Gene from Literature | N/A |