| Detail of EST/Unigene TCMT49493 |
| Acc. | TCMT49493 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=5e-53; Thioredoxin M-type, chloroplastic OS=Spinacia oleracea E-value=4e-51; Thioredoxin M5, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-48; Thioredoxin M-type, chloroplastic OS=Zea mays E-value=1e-46; Thioredoxin M-type, chloroplastic OS=Triticum aestivum E-value=1e-44; |
| Length | 961 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2 (8 ESTs); MT_DSIL (8 ESTs); MT_DLEAF (7 ESTs); MT_VILEAF (6 ESTs); MT_DSLC (5 ESTs); MT_JCVI-MT1 (4 ESTs); MT_CDS (2 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_SIRRA (2 ESTs); MT_KVKC (2 ESTs); MT_Drought (2 ESTs); MT_FLOSEED_MTY (2 ESTs); MT_INSECT (2 ESTs); MT_LEAF_PHOMA (2 ESTs); MT_PhoLEAF (1 ESTs); MT_GSEED (1 ESTs); MT_Shoots (1 ESTs); MT_GPOD (1 ESTs); |
| Sequence | GAGATTTCAAACCAAACAAATTAAAAACCACCAAAACACTAGAAGCTTATCCACAAGTGC |
| EST members of Unigene | BT053469 BT051337 CF068272 CA918906 CX541501 CX527989 EV261970 EV260333 EV256813 EV256008 DW017836 DW015373 BF006286 BF005886 BF005349 BF005162 BF005025 BQ141101 BQ139222 BE316846 BE316817 BE315972 BE316004 BF637202 BF636986 BF636722 BI308803 BF520368 BF520271 BF519863 BF519698 BF518669 BE124272 AW776634 AW775360 BI263841 BQ155065 BI268937 CX523261 CX521928 CX520450 CX520042 CX519422 CX518699 BQ165817 BQ165687 BE248251 BF633738 BI266795 BI266484 GE350396 GE351652 GE348635 GE347227 GE348499 GE345441 GE343525 GE343405 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.42854.1.S1_at
|
| Corresponding NCBI Gene | 820775 |
| Trichome-related Gene from Literature | N/A |