| Detail of EST/Unigene TCMT55722 |
| Acc. | TCMT55722 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Profilin-1 OS=Phaseolus vulgaris E-value=1e-56; Profilin OS=Litchi chinensis E-value=3e-54; Profilin OS=Fragaria ananassa E-value=4e-54; Profilin-3 OS=Hevea brasiliensis E-value=6e-54; Profilin-1 OS=Ricinus communis E-value=6e-54; |
| Length | 910 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought (7 ESTs); MtBB_NOD (6 ESTs); MT_NOD_NOLLY (5 ESTs); MT_DFLOWER (4 ESTs); MT_JCVI-MT2 (4 ESTs); MT_JCVI-MT1 (4 ESTs); MtBC_GLOMUS (4 ESTs); MtBA (3 ESTs); MT_DSLC (3 ESTs); MT_SIRRA (3 ESTs); MTAMP (3 ESTs); MHRP-root (2 ESTs); MT_KVKC (2 ESTs); MT_DSTEM2 (2 ESTs); MT_NOD_GVSN (2 ESTs); MT_CDS (2 ESTs); MT_JAS_ROOR (2 ESTs); MtRHE (1 ESTs); MT_DROOT (1 ESTs); MT_GSEED (1 ESTs); MT_DSIL (1 ESTs); MT_ECELL (1 ESTs); MtSNF (1 ESTs); MTPOSE (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_NOD_GVN (1 ESTs); MT_PhoLEAF (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_ROOTPHOS (1 ESTs); MT_HOGA (1 ESTs); MT_GESD (1 ESTs); |
| Sequence | TCATGAATAAATAATAATATCTTTTTTCCTTTTTCATTTTCCATTATGCGCCAGCCAGAA |
| EST members of Unigene | BT053464 BT051303 DY618241 DY618208 DY617611 DY617118 DY616631 CA922431 AL389428 AL389427 AL386026 AL386025 AL380964 AL380963 AL379395 AL378771 AL373653 AL373652 AW687012 CX541143 AW696862 BE325990 BF645661 EV262637 EV261934 EV256356 EV254783 BE999749 BE998405 BE124776 BF006617 BF006223 BF004991 AW329219 AJ504315 AJ503326 AJ501784 BI310614 BG588894 BE239887 BQ148790 BQ146785 BI272120 BI270322 BE123954 AJ845663 AJ498620 BE204471 BE324316 BQ155668 BQ154124 BI269260 CX532538 CX532094 BG648356 AA660724 BQ165357 BQ165356 AL371911 AL369114 AL369113 BE315572 BF636085 BF635844 BF635441 BF635415 BF634714 BF632770 GE351209 GE346610 GE346609 GE344986 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1922.1.S1_at, Mtr.43063.1.S1_at
|
| Corresponding NCBI Gene | 816495 |
| Trichome-related Gene from Literature | 816495 |