| Detail of EST/Unigene TCMT58852 |
| Acc. | TCMT58852 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=0; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=0; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=0; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=0; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=0; |
| Length | 1996 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT (5 ESTs); MT_JCVI-MT2 (4 ESTs); MT_DFLOWER (3 ESTs); MT_GPOD (3 ESTs); MtSNF (3 ESTs); GLSD (3 ESTs); MT_PhoLEAF (3 ESTs); MT_NOD_NOLLY (2 ESTs); MT_HOGA (2 ESTs); MtBB_NOD (2 ESTs); MtBA (2 ESTs); MT_Drought (2 ESTs); MT_DSTEM2 (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_NOD_GVSN (2 ESTs); MT_NOD_GVN (2 ESTs); MT_SIRRA (2 ESTs); MT_CDS (1 ESTs); MT_ROOTPHOS (1 ESTs); MT_VILEAF (1 ESTs); MT_JAS_ROOR (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_DLEAF (1 ESTs); MtBC_GLOMUS (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_DSIL (1 ESTs); MT_GSEED (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_ECELL (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_TRI (1 ESTs); |
| Sequence | ATTTCTTAGAGACTTTTGTCAATTATTTTTCTTTTTTCTTCAGAGAGTATGTACAAATAT |
| EST members of Unigene | BT051956 DY617339 DY616918 CA922475 AL383779 AL377575 AL377574 CX541915 AW691673 AW695938 BF644591 EV256880 EV255912 BE998889 BE998745 BG583142 AW573893 AW329621 BI273148 BI271700 BI271357 BF637086 CB066709 BI309294 BI308982 BF519749 AJ845430 AJ845372 AJ845357 BM779537 BE204193 BQ123327 BQ122191 BQ122179 BI264811 BI264595 BG456870 BQ156837 BQ154657 CX521213 CX532677 CB893836 BG648172 BF003629 AL368876 AL367066 BF635826 BF633340 BI267460 BI266483 BI266263 BF640977 BF639944 GE349815 GE348768 GE344772 GE343579 EX532526 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2782.1.S1_at, Mtr.43082.1.S1_at
|
| Corresponding NCBI Gene | 820387 |
| Trichome-related Gene from Literature | 820387 |