| Detail of EST/Unigene TCMT42140 |
| Acc. | TCMT42140 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase 2 OS=Vitis vinifera E-value=1e-97; 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase 3 OS=Arabidopsis thaliana E-value=6e-95; 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase 2 OS=Arabidopsis thaliana E-value=2e-92; 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase 1 OS=Arabidopsis thaliana E-value=2e-87; 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase 2 OS=Oryza sativa subsp. japonica E-value=4e-86; |
| Length | 2344 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA (16 ESTs); MT_JAS_ROOR (11 ESTs); MT_GSEED (9 ESTs); MT_JCVI-MT2 (6 ESTs); MT_NOD_NOLLY (5 ESTs); MT_DSTEM2 (5 ESTs); MT_SEEDROOT_KV3 (4 ESTs); MT_DLEAF (4 ESTs); MT_NOD_GVSN (4 ESTs); MtBA (4 ESTs); MtBB_NOD (4 ESTs); MT_IROOT_DSIR (4 ESTs); MT_ECELL (4 ESTs); MT_JCVI-MT1 (3 ESTs); MT_DFLOWER (3 ESTs); MT_KVKC (3 ESTs); MtBC_GLOMUS (3 ESTs); MT_MGHG (3 ESTs); MT_SROOT_KV2 (3 ESTs); MT_Drought (3 ESTs); MT_CDS (2 ESTs); MT_FLOSEED_MTY (2 ESTs); MT_NOD_GVN (2 ESTs); MT_DROOT (2 ESTs); MT_INSECT (2 ESTs); MT_ROOTPHOS (2 ESTs); MT_PhoLEAF (2 ESTs); MHRP-root (2 ESTs); MT_HOGA (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_GPOD (1 ESTs); MT_DSIL (1 ESTs); MT_DSLC (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_JCVI-MT3 (1 ESTs); MTAMP (1 ESTs); MT_Shoots (1 ESTs); MT_GESD (1 ESTs); MT_VILEAF (1 ESTs); MT_BML (1 ESTs); MT_TRI (1 ESTs); |
| Sequence | GATCCTATCCAGCAGCAACGATGAAAATGGCTCCAACAATTCTGCCCCTGGTCACCTTAT |
| EST members of Unigene | BT052508 BT052072 DY618234 DY617994 DY617716 DY617603 DY616227 AL382299 AL381339 AL381338 AL378153 AL378152 AL377688 AL377687 AW687212 BE320635 CX538291 CX538268 CX538124 CX537275 CX537200 CX536534 CX536186 BQ146133 BI268728 AW560815 AW267769 AW267734 AW267720 CX526071 AW690501 BE325203 AW694362 AW697031 AW693970 BF649634 BF649529 BF648961 BF644644 EV261099 EV258127 EV257957 DW017938 DW016998 BE999378 BE998985 BE997721 BE997591 BG583647 AW127177 BF005921 AW686069 AW329854 AW329207 AJ503920 BI311377 BG589095 BG589048 CB892360 CB891446 CB891362 AW774241 BQ147020 BQ146925 BI270873 BG454845 BG452974 BG452772 BG452707 CA918133 BE124279 AW299212 AW256440 AI974561 BE204070 BG456450 BG455380 BQ157689 BQ157588 BQ157509 BQ156749 BQ156217 BQ156110 BQ155549 BQ155277 BQ155045 BQ154385 BQ154356 BQ154339 BQ153227 BI269446 BI269393 BI269069 CX520440 CX535305 CX535211 CX535138 CX534655 CX532873 CX532784 CX532640 CX531931 CX531322 CX530481 CX530342 CB895048 BF004076 BQ750539 BQ165088 BQ164864 AL368963 AL368962 AL368161 AL368160 BE943020 BE942359 BE941931 BG450490 BF633616 BF633397 BI265574 BI264971 EY476337 GE352792 GE350436 GE352020 GE348533 GE347648 GE345488 GD185537 EX526524 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K08967 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase |
| EC | 1.13.11.53 1.13.11.54 |
| Transcription Factor Family | |
| Transporter Classification Family | 2.A.9 Cytochrome oxidase biogenesis factor Oxa1 |
| Probeset |
Msa.1909.1.S1_at, Mtr.26549.1.S1_at, Mtr.37459.1.S1_at
|
| Corresponding NCBI Gene | 839538 |
| Trichome-related Gene from Literature | N/A |